| M W F; 10:10 - 11:00 pm |
Molecular Biology |
Douglas W. Smith |
| York 2722 |
BIMM 100 |
5254 Muir Biology Building |
| Fall, 2000 |
x42620; dsmith@ucsd.edu |
| BIMM100 | Syllabus
| Sections / Off Hrs | Grading
Policy | DNASYSTEM
|
| Lectures | Journal
Articles | Study Qs | Lab
Techniques | Exams |
This Study Question Web page contains questions on the topics, lectures, and journal articles for BIMM 100, Molecular Biology, and will be updated during the course for the topics presented and journal articles used during Fall, 2000. The Study Questions from Winter, 1999, are available in the Soft Reserves Course Reader.
These questions are of different types. Some are straightforward questions on lecture material. Some are numerical calculations. Some introduce new but related material. Some are questions from previous BIMM 100 exams.
Molecular Biology and the Genetic Material
DNA Primary and Secondary Structure
DNA Tertiary Structure
Eukaryotic DNA and Chromatin
Recombinant DNA Technology
DNA Replication - Basics
DNA Replication - Enzymology
Eukaryotic DNA Replication
DNA Replication - Initiation
Control of DNA Replication
Telomeres and Telomerase
DNA Repair
Homologous Recombination
Mobile Genetic Elements - Prokaryotic Transposable
Elements
Retroviruses and Retroposons
Prokaryotic RNA Transcription
Regulation of Prokaryotic Gene Expression
The Lac Operon
Catabolite Repression
The Trp Operon
Bacteriophage Lambda
Eukaryotic RNA Transcription
mRNA Processing - Basics
Introns and Exons - Splicing
Genetic Code
Translation - Components
and tRNA
Ribosomes
Translation - Process
Translation - Initiation
Translation - Elongation
Translation - Termination
Reading Frames
Eukaryotic Gene Regulation
Signal Transduction
Whole Genome Analysis
Burke et al - YAC paper
Depamphilis - Eukaryotic
DNA Rep paper
DNA Repair perspectives
Gross et al - HtpR paper
Karin et al - Metallothionein
paper
Bult et al - Methanococcus genome
paper
What is the Central Dogma of Molecular Biology? Which are "2-way streets", which are not?
What is the Chromosomal Theory of Inheritance?
Why was protein thought to be the genetic material?
What early evidence was there that DNA was the genetic material?
What were the Griffith experiments? What was their conclusion?
What was the Avery-MacLeod-McCarty experiment? What evidence showed that DNA was the genetic material? What was the assay for genetic information?
Why was the genetic material called "Transforming Activity"?
What was the Hershey-Chase experiment? What did it show that the Avery et al experiment did not?
What evidence is there that DNA need not be the genetic material?
What are the three levels of DNA structure? What structural features do each of these levels include?
Know the structure of a nucleotide. Know the structure of its three components.
Know the structure of the 5 bases found in DNA and RNA.
Be able to draw each of the 4 nucleotides.
Be able to draw a dinucleotide, eg 5'-pApT-3'
Be able to draw a base pair, eg A:T
What are the primary structure differences between RNA and DNA?
What are the secondary structure differences between RNA and DNA?
What are Chargaff's rules?
What are the major features of the B-form of DNA? of the A-form of RNA?
What is meant by the DNA double helix being "anti-parallel"?
Be able to draw the short-form nomenclature of a nucleic acid molecule.
Why is the double-helical structure of
DNA excellent for a mechanism of DNA replication?
for a mechanism for DNA repair? for DNA transcription?
What are the major and minor grooves of DNA?
How in general do proteins bind to DNA?
What functions do such proteins play in the cell?
Provide three examples of DNA tertiary structure.
What is supercoiled DNA?
What is the naturally occurring superhelical density in DNA?
What is the Linking Number L?
What is the Twisting Number T?
What is the Writhing Number W?
What are the values of L, T, and W in a 5000 bp naturally occurring DNA which is:
a. linear;
b. open-circular; or
c. supercoiled ?
How does Ethidium Bromide (EtBr) interact with DNA?
How can EtBr be used to assay for the presence of DNA? for the quantitative amount of DNA?
What happens to supercoiled DNA when EtBr is added to it, as a function of amount of EtBr added?
Question from Fall 1994 BIBC, Structural Biochemistry, final exam:
Ethidium bromide (EtBr) intercalates between bases in double-stranded DNA (dsDNA), decreasing the number of twists in the DNA. The superhelicity of a closed circular dsDNA molecule can be measured in an agarose gel: the greater the superhelicity, the faster it moves through the gel. Assume a closed circular DNA species has 5,000 bp and a superhelical density of -0.05. At a concentration A of EtBr, the DNA moves slowest. At a higher concentration B (B>A), the DNA moves at the same rate as in the absence of EtBr.
a. Briefly define the parameters L, T, and W.
b. What are the values of L, T, and W at zero concentration of EtBr?
c. What are the values of L, T, and W at concentration A of EtBr?
d. What are the values of L, T, and W at concentration B of EtBr?
e. At zero concentration of EtBr, the DNA is linearized with a restriction enzyme.
What are the values of L, T, and W for the linear DNA?
What are possible physiological functions of supercoiling in DNA?
What is a "nick" in dsDNA? What is a "chop"?
What happens to L, T, W when supercoiled DNA is nicked? when it is chopped?
What is a Topoisomerase?
What are the properties of Topoisomerase I enzymes? What is the enzyme mechanism?
What are the properties of Topoisomerase II enzymes? What is the enzyme mechanism?
What is the most common TopoII enzyme in E. coli? What is its primary physiological function?
What is the Packing Ratio?
What is a bacterial Nucleoid? What are the Domains of the Nucleoid, and what are their properties?
What proteins are thought to interact with the bacterial DNA to form a Nucleoid?
What is the structure of the naked (protein depleted) bacterial chromosome?
What is Chromatin? Euchromatin? Heterochromatin?
What is Constitutive versus Facultative Heterochromatin? Give an example of each.
What functionally can Eucharomatin do that Heterochromatin can not do?
What are the three main levels of structural organization found in chromatin?
What are the two classes of proteins found in chromatin?
What is a histone?
What is a nucleosome?
What are the structural components of a nucleosome?
Be able to draw schematically the structure of the histones and DNA in a nucleosome.
What are the five classes of histones found in nucleosomes?
Which histones are found in the core nucleosome, and how do they interact?
What is the secondary structure of a histone?
How does the DNA interact with the histones in a nucleosome?
What is the superhelical content of a nucleosome? Is this what one would expect? If not, how is the paradox resolved?
Is there superhelical content in chromatin other than that in a nucleosome? If so, how does one distinguish between the two classes of superhelices?
What is the length of DNA found in a core nucleosome?
What is the length of DNA found in a nucleosome released by Micrococcal nuclease digestion?
If these numbers are different, why are they different?
How do they differ from one eukaryotic organism to another?
What is the function of Histone H1 in the nucleosome?
How are nucleosomes related to the 10 nm fiber structure of chromatin?
What is the 30 nm fiber structure of chromatin?
What is the function of Histone H1 in the 30 nm fiber structure?
What is the Packing Ratio of free DNA? of 10 nm fibers? of 30 nm fibers? of heterochromatin?
What are the structural features of chromatin when depleted of histones?
What is a Matrix Attachment Site (MAR)?
What is the Scaffold? Where is it found? How might it be related to the MAR?
What type of experiment showed that the histone octamer found in a nucleosome is not conserved during DNA replication?
What is likely to be the conserved nucleosome histone complex?
What is a Chaperonin?
What are the four key discoveries that led to the Recombinant DNA Technology revolution?
What is a Restriction Enzyme?
What features of a Type II Restriction Enzyme are important for recombinant DNA work?
What is a "sticky end", and why is it said that some R.Enzymes generate "sticky ends"?
An example of a Type II R.Enzyme is NcoI which recognizes and cuts as shown: C'CATGG
Why is this enzyme called a "6 cutter"?
Why is this 6-bp sequence called a "nucleotide palindrome"?
What is the sticky end generated?
In the following DNA sequence, draw both strands of the product molecules following NcoI digestion:
GGAATTCCATGGAATTCGATCCTTGACTAAGTCCATGGGGACCTAATTCC
What does the nomenclature "NcoI" mean?
What is the average size of DNA generated by a "4 cutter"? What is the typical size distribution of DNA generated by a "4 cutter"?
What does "Gel Electrophoresis of DNA" mean?
What is a "slab gel"?
What two materials are commonly used to make gels for gel electrophoresis?
Why do DNA molecules separate from each other during gel electrophoresis?
What is the nature of the force that moves DNA molecules in gel electrophoresis?
How can one determine approximate size of DNA molecules via gel electrophoresis?
Briefly describe a gel electrophoresis experiment.
How does one visualize DNA in a gel experiment using fluorescence, eg via EtBr?
How does one visualize DNA in a gel experiment when the DNA is radioactively labeled?
What is the relative intensity of DNA bands in an agarose gel experiment when EtBr is used to detect the bands for DNA fragments of sizes 100 bp, 600 bp, 400 bp, 200 bp?
What would be the relative intensity of these same bands if the DNA were end-labeled with P32 and the radioactivity were detected?
What would be the relative intensity of these same bands if the DNA were uniformly labeled with P32, eg in a PolI synthesis experiment, and the radioactivity were detected?
What is a Physical Map of a Genome?
How does a Physical Map differ from a Genetic Map of a Genome?
How are the Physical Map and Genetic Map similar? different?
What is meant by the "resolution" of the Physical Map?
What is the "ultimate" physical map of a genome?
What is a restriction map? why is it an example of a physical map?
Provide 3 examples of restriction maps which are different resolution physical maps.
A restriction map is uniquely defined when each R.fragment position and orientation are determined.
What is not uniquely defined in determining a restriction map using only a single R.enzyme?
Will using a second R.enzyme and including double digest data always yield a unique Restriction map?
Why or why not?
What information does a partial digest approach give that a total digest does not give?
Why is a partial digest approach coupled with end-labeling, eg with P32, a powerful approach?
What is an RFLP?
How is an RFLP used as a genetic marker? understand Lodish, Figure 8.22
What is a polymorphism?
What is a genetic allele?
What are the "alleles" associated with an RFLP?
What is the "phenotype" associated with an RFLP?
Is the "phenotype" associated with an RFLP always a biological phenotype? sometimes? never?
Provide 3 uses of RFLPs.
What is a "Cloning Vehicle"?
What are the required features of a Cloning Vehicle?
What are desirable features of a Cloning Vehicle?
Give 3 examples of types of cloning vehicles.
State whether each of the following is or is not a desirable feature of Cloning Vehicles or Vectors. Briefly explain why or why not.
a. Autonomous replication
b. Unique restriction sites
c. Gene(s) that confer antibiotic resistance
d. Small size
e. Circularity
What is a Plasmid?
What is a YAC? How is it different from a Plasmid? How is it similar?
How does a Plasmid cloning vehicle differ from a YAC cloning vehicle?
What is the MCS region?
What are the features of a YAC cloning vehicle?
What is an ARS? a CEN? a TEL?
Give 3 examples of types of DNA species that one might wish to clone.
Understand the steps involved in a cloning experiment.
What step in a cloning experiment is the actual "cloning" step?
What features of a Type II R.enzyme make possible cloning experiments?
Cloning Experiments are the source of the word "recombinant" in Recombinant DNA Technology. Explain why.
Cloning experiments are often used to isolate genes.
Why is this difficult to do with mammalian genomes?
What is a "complementation assay" is the cloning, for example, of a bacterial gene?
What is Reverse Genetics? What are the steps in a Reverse Genetics approach to cloning a gene?
Design a strategy to clone the E. coli origin of DNA replication.
Restriction mapping problem: An EcoRI fragment is cloned into
the EcoRI site in the MCS of pGEM3, a cloning vehicle of size
about 2800 bp, resulting in a chimeric plasmid called pBIMM100.
You purify pBIMM100 DNA and restrict the DNA in separate experiments
with EcoRI and with HindIII, and do a double digest experiment
with both EcoRI and HindIII. When analyzed on agarose gels, you
find the following fragment sizes:
EcoRI single digest: 2800, 1500, 800, 500, 300 bp
HindIII single digest: 2800, 1000, 900, 600, 500, 100 bp
RI-HIII double digest: -> means "yields", to indicate double digest fragments from single digest frags
EcoRI frags: 2800->2800; 1500->800,700; 800->300,500; 500->100,400; 300->200,100 bp
HindIII frags: 2800->2800; 1000->700,300; 900->100,800; 600->400,200; 500->500; 100->100 bp
1. What is the 2800 bp band? Why is it present independent of which R.enzyme is used?
2. Deduce a restriction map for your cloned DNA. Can you deduce a UNIQUE restriction map?
3. Why is the 100 bp band in the double digest of twice its expected intensity?
4. What is the size of the cloned insert?
5. Attempt to deduce the restriction knowing ONLY the sizes of the fragments generated in the double digest but NOT which single digest fragment they came from. That is, from the double digest experiment, you know only the sizes of the fragments:
Double digest: 800, 700, 500, 400, 300, 200, 100 bp
You note in the double digest that the intensity of the 100 bp band is twice what it should be.
6. Having deduced your restriction map, suppose that the EcoRI site closest to one end of your insert were absent. What would the sizes of the remaining EcoRI fragments be? of the HindIII fragments? of the double digest fragments? Given these sizes, could you now deduce a UNIQUE restriction map? If not, what is not unique about the restriction map?
7. Repeat part 6 for the EcoRI site at the OTHER end of your insert.
8. Repeat part 6 for the HindIII sites closest to each end of your insert.
What is a Southern Gel? Understand the steps in a Southern analysis experiment.
How were Southerns used in the Burke-Olson YAC paper? What information did these experiments provide that could not be provided by gel analysis alone?
How did Burke-Olson use "end labeling" to begin an analysis of cloned yeast DNA?
Once a gene is isolated via cloning, how would you proceed in analysis of the cloned DNA?
What is a cDNA?
What is cDNA cloning?
What is a "bacterial factory"?
What are the overall principles of DNA replication?
What are the three stages or processes that occur during DNA replication?
At which stage does one find temporal control of DNA replication? What does temporal control of DNA replication mean?
What is a Replicon? Provide three examples of replicons. Provide an example of a DNA molecule that is NOT a replicon.
What does Sequential replication mean?
What is a CsCl gradient? What property of DNA is used for separation of DNA molecules in a CsCl gradient? What is the purpose of Cs++ ions in a CsCl gradient? Why does DNA form a band in a CsCl gradient?
In a density labeling expt, one can analyze differences in an object before and after its density labeling.
Explain how this was done by Meselson and Stahl for DNA in the process of replication.
Explain how this was done to examine whether histone octamers are conserved during nucleosome turnover.
The Meselson-Stahl expt showed that DNA replication proceeds semi-conservatively in bacteria. What alternatives to semiconservative replication can you think of?
In the Meselson-Stahl expt, why was examination of DNA in a CsCl gradient after its denaturation important to do?
Why do you think that the results obtained by Meselson-Stahl for denatured E. coli DNA were different from those obtained with denatured salmon sperm DNA?
Meselson-Stahl used N15 as a density label. What other isotopes could be used?
5-Bromo-Uracil (5BU) has often been used in density labeling experiments. 5BU is Uracil with a Bromine atom at the 5' position; it also is Thymine with Bromine substituted for the methyl group. A bromine atom is about the same size as a methyl group.
Draw the structure of 5BU.
Why would use of a thy- mutant of E. coli be important in a 5BU incorporation experiment?
5BU is incorporated instead of Thymine during DNA replication. Why do you think 5BU is a good mimic of Thymine for "fooling" HoloPolIII?
Why do think 5BU would be a good "density label" when compared with Thymine?
In this comparison with Thymine, do you think 5BU would provide a greater density shift than labeling with N15 ? a lesser density shift? about the same density shift? Why?
What growth procedure would you use for the 5BU density labeling experiment?
Meselson-Stahl used UV absorption to assay the DNA in their density labeling experiment. Radioactivity is usually used in 5BU density labeling experiments.
How would you do this using one radioisotope, for example, H3 ?
How would you do this using two radioisotopes, for example, H3 and C14 ?
Compare and contrast prokaryotic replication origins with eukaryotic origins.
Compare and contrast prokaryotic replication terminus regions with eukaryotic terminus regions.
What are the differences between BiDirectional and UniDirectional modes of DNA replication?
What is Theta structure for a DNA replication intermediate?
Can you tell from an autoradiogram of such a Theta structure whether replication proceeds unidirectionally or bidirectionally? Why or why not? What additional info is needed to make this determination?
Electron microscopy of restriction fragments of replication intermediates has been used to determine if the mode of replication is unidirectional or bidirectional. What additional info does such an experiment provide beyond that of autoradiography of Theta structures?
What is the special problem for DNA replication posed by linear replicons? Provide one solution to this problem used by some small prokaryotic replicons.
How is the problem posed by linear replicons solved in eukaryotic chromosomes?
What does Semi-Discontinuous DNA replication mean? What would Discontinuous mean? What would Continuous mean?
What is the Leading Strand of DNA synthesis at replication forks?
What is the Lagging Strand of DNA synthesis at replication forks?
What are the structural features of E. coli DNA polymerase I (PolI)?
What are its three major enzymatic activities?
What is novel about the substrate requirements for PolI and other DNA polymerases?
What are the three DNA substrate requirements for PolI and other DNA polymerases?
Understand what is meant by DNA Template, DNA Primer, DNA Primer Terminus.
What is the basic reaction for DNA polymerization?
What is meant by "proof-reading"? Why is this associated with the 3'->5' Exo activity of PolI?
What is an Exonuclease? an Endonuclease? a Nuclease?
What does 3'->5' mean? What does 5'->3' mean?
The 3'->5' Exo activity of PolI catalyzes a hydrolysis reaction. What does this mean? How does this differ from the 5'->3' Polymerization reaction? What would the reverse reaction to the polymerization reaction be? (This is a pyrophosphorolysis reaction ... also catalyzed by PolI ...)
What is mean by "fidelity" of DNA replication? How is "proof-reading" related to "fidelity"?
What does the 5'->3' Exo activity of PolI catalyze?
Understand Nick Translation and what PolI catalytic activities are required.
What role does Nick Translation play during DNA replication in E. coli?
Match the properties or functions in the right column with the DNA polymerase in the left column:
a. DNA PolI 1. Involved in DNA replication
b. DNA PolII 2. Requires a DNA primer and DNA template
c. DNA PolIII 3. Physiological function is unknown.
4. Makes most of the DNA during DNA replication
5. Removes the primer and fills in the gaps during DNA replication
PolI is commercially available from StrataGene and elsewhere.
Design a cloning experiment to clone the polA gene, the gene encoding PolI, from E. coli. Assume you have NO polA mutants.
If you were CEO of StrataGene, why might cloning the polA gene be useful for you?
Understand the essential features of a Sanger DiDeoxy Sequencing experiment.
Understand the essential features of a Maxam-Gilbert Chemical Sequencing experiment.
Understand the essential features of a Polymerase Chain Reaction (PCR) experiment.
What is a DiDeoxynucleotide? Be able to draw each of the 4 dideoxynucleotides.
Why are diddeoxynucleotides called "chain terminators"?
Why are four sequencing reactions performed in Sanger sequencing?
What is a Sequencing Gel? How does it differ from a standard R.fragment agarose gel?
What are the two most common assay methods used to detect DNA fragments in a sequencing gel?
What is a "nested set" of DNA fragments? Why is this concept important is understanding DNA sequencing methodologies?
Understand how to determine the sequence of a DNA fragment by "reading" the sequencing gel.
How does a Maxam-Gilbert Chemical sequencing experiment differ from a Sanger DiDeoxy sequencing experiment? How is it similar?
Why is there a requirement for radioactive label at ONE END ONLY of a DNA fragment for use of this fragment in a Maxam-Gilbert sequencing experiment?
Why is it easier to make a more highly labeled nested set of radioactively-labeled DNA fragments by Sanger dideoxy sequencing than by Maxam-Gilbert chemical sequencing?
PCR is a combination of what two types of procedures?
What is the role of DNA denaturation in PCR? of renaturation? of polymerization?
How are these procedures combined into a single cycle procedure?
Why is use of heat-resistant DNA polymerases such as Taq polymerase useful in PCR?
What is Taq polymerase?
Why does the amount of DNA increase exponentially as a function of number of PCR cycles?
PCR can be used to prepare the nested set of fragments for a Sanger dideoxy sequencing experiment. In this PCR application, only one Primer is used and ddNTPs are included as well as the dNTPs.
Describe more completely how you would do this experiment.
In this experiment, the amount of DNA increases arithmetically rather than exponentially. Why is this the case?
What are the physiological functions of each of the three E. coli DNA polymerases?
What are the phenotypes of mutations in each of their structural genes (polA, polB, polC)?
Why is a genetic analysis of DNA replication a good way to begin a study of the DNA replication process?
What types of mutants would you isolate? Why?
What three major classes of E. coli dna mutants have been isolated? Which step in DNA replication would you expect the gene products of each of these three gene classes to be involved?
How have the E. coli dna mutants been used to purify DNA replication proteins?
What is the other major approach used to purify DNA replication proteins?
DNA from the small E. coli bacteriophage phiX174, G4, and M13 were used by Kornberg and coworkers to purify and assay E. coli DNA replication proteins. Why was this a good approach? Why not use E. coli DNA?
Understand the structure of E. coli HoloPolIII.
In what ways is HoloPolIII a symmetric protein complex? Why is this important in DNA replication?
In what ways is HoloPolIII a asymmetric protein complex? Why is this important in DNA replication?
What is the function of the HoloPolIII a subunit? the e subunit? the b subunit? the gd complex?
Note that several of these subunits of HoloPolIII are the gene products of dna genes. You do NOT need to memorize the names of these genes.
Which of the following statements about HoloPolIII from E.coli are correct?
a. It elongates a growing DNA chain approximately 100 times faster than PolI.
b. It associates with the parental template, adds a few nucleotides to the growing chain and then dissociates prior to initiating another synthesis cycle.
c. It maintains a high fidelity of replication, in part by acting in conjunction with a subunit containing 3'->5' exonuclease activity.
d. When replicating DNA, it is a molecular assembly composed of at least eight different kinds of subunits.
e. It adds deoxynucleotide units to the 3'-hydroxyl of a primer.
f. It contains two nuclease activities in the same polypeptide chain that contains the polymerization active site.
Replication proceeds at replication forks in E. coli in a Semi-Discontinuous manner.
What does Semi-Discontinuous mean?
What property of DNA polymerases results in the need for Semi-Discontinuous synthesis?
What is an Okazaki fragment?
What is the "priming problem" for synthesis of an Okazaki fragment?
Why is an RNA primer a good solution to the priming problem?
What is a Helicase? Which is the major Helicase used at replication forks in E. coli?
What is SSB, and what is its function?
What is the Primosome? what are the protein components of the Primosome? what is the function of the Primosome?
What is a Primosome Assembly Site?
What is a Primase?
What are the two functions of DnaB protein in chain elongation at E. coli replication forks?
What are the functions of PolI and DNA ligase in the chain elongation process?
Why is DNA Gyrase involved in DNA replication and what does it do?
What are the 5 types of eukaryotic DNA polymerases?
How do these compare with E. coli HoloPolIII, PolI, and other proteins of DNA replication?
What other eukaryotic proteins are needed for eukaryotic DNA replication?
What are their analogues in E. coli?
What is the structure of E. coli oriC DNA?
What are the 3 protein complexes which distinguish the Initiation process from the Elongation process in E. coli?
What are the two roles of DnaA protein in formation of these complexes?
What protein events are similar in Initiation and in Elongation?
What are the 5 types of eukaryotic DNA polymerases and what DNA synthesis events do they catalyze?
Correlate the activities of Pol a and Pol d with similar prokaryotic replication enzymes and activities.
Which eukaryotic DNA polymerases would be most similar to E. coli PolI? How do they differ?
Compare Pol g with prokarotic DNA polymerases.
What features of eukaryotic DNA replication are similar to those of E. coli DNA replication?
Which are different?
What is PCNA and what is its role in eukaryotic DNA replication?
What other proteins besides DNA polymerases and PCNA are involved in eukaryotic DNA replication?
What is meant by a Round of DNA Replication?
What is the major phenotypic property of E. coli mutants difficient specifically in initiation?
What are the three major types of structural properties (sites) of the E. coli origin oriC?
What roles do these three types of sites play in initiation?
How is it known that spacing between these sites is important?
What is the Initial Complex formed in Initiation at oriC? What protein(s) is(are) involved?
What is the Open Complex and how does it differ from the Initial Complex?
What is the Pre-Priming Complex? What proteins are involved?
What are the remaining events involved in establishment of the first elongation fork?
How to these events compare with events during chain Elongation?
It is said that the only UNIQUE initiation steps needed are those used to establish Leading Strand synthesis at the First Elongation Fork, even though replication in E. coli is bidirectional. Why is this so?
How can the first Okazaki Fragment at the 1st elongation fork form the leading strand for a 2nd fork?
Control of DNA replication occurs at Initiation and not at Elongation. What evidence supports this statement?
What role does GATC methylation play in regulation of the Initiation process?
What is hemimethylated DNA, and why is this important in control of the initiation process?
Immediately after initiation, do the two daughter origins have identical structure? Why or why not?
Most bacteria do not possess the Dam methylase. What possible mechanisms might they have to substitute for the role of GATC methlation in regulation of their Initiation processes?
What is the connection between hemimethylated DNA and the bacterial cell surface?
What role(s) might DnaA protein play in control of initiation?
How might control of DnaA gene expression be important in control of initiation?
Why is a negative feedback control mechanism of some kind essential for any control process?
What is ColE1?
Why is ColE1 important in recombinant DNA technology?
What are the enzymatic events that occur in ColE1 initiation of a round of DNA replication?
What enzymes are involved in these events?
What molecule is the major negative control element for ColE1 initiation? How does it work?
What is a Telomere? What TWO functions does it perform?
Why are Telomeres absent from prokaryotic chromosomes?
What is the basic structure of a Telomere? Correlate this structure with the 2 functions of a Telomere.
Design a strategy to isolate a Telomere (or two) using recombinant techniques in a cloning experiment.
What is the length of a Telomere?
What is the function of Telomerase? What is its structure? What are the steps in its catalysis?
Telomerase is sometimes called a Reverse Transcriptase. Why is this so?
What is meant by the statement: Telomeres can be repaired. ?
Why is the concept that Telomeres can be repaired important in recombinant DNA work?
Lewin makes the statement "yeast
telomeric repeats are added onto the ends of the Tetrahymena repeats".
When would this occur, and how can this occur?
What is the structure of the Telomere end? Correlate this structure with the 2 functions of a Telomere.
What is the experimental evidence for this structure?
What is a Hoogsteen pairing?
How does this Telomere end structure readily account for complete synthesis of Telomere DNA?
What happens to the 3' and 5' ends of eukaryotic chromosomes as a result of Telomere synthesis?
Is the eukaryotic chromosome then a "circular" chromosome?
What are the two types of DNA "damage" that occur involving 1 or 2 DNA base pairs?
What is a "mismatch"?
What is oxidative deamination? Name 2 bases whose oxidative deamination is most important.
Why is the presence of Uracil in DNA bad? What 2 ways does Uracil usually arise in DNA?
What is the Recognition or Strand specificity Problem in DNA repair?
What are the 3 main ways that the Recognition Problem is solved in E. coli?
What is meant by "direct" repair?
What is apurinic or apyrimidinic DNA?
What is a mutator gene? Give a couple of examples of mutator genes in E. coli. Why do mutator genes often have other names? What are a couple of examples of such names?
What is Photoreactivation?
What are the steps in photoreversal catalyzed by the PR or Photolyase enzyme?
What type of damage does the Ada protein repair? How does it do this?
In catalyzing repair, the Ada protein deactivates itself. What is the mechanism to insure surfficient Ada protein is present in the cell for such repair?
What are the four basic steps in Nucleotide Excision?
Which of these steps are catalyzed by the E. coli UvrABC enzyme, and how is this done?
What enzymes does E. coli have to catalyze the other steps?
Why is nucleotide excision sometimes called "cut and patch" repair?
Outline a nucleotide excision pathway that would fit "patch and cut" rather than "cut and patch".
PolI is said to catalyze mainly "short" patch repair. What does this mean? What is "long" patch repair?
What are the unique types of enzymes associated with Base Excision Repair?
What features of repair does Base Excision repair have in common with Nucleotide Excision repair?
How is the double-stranded structure of DNA used in these repair processes?
What type of DNA repair is the double-stranded structure of DNA NOT used?
How is strand specificity solved in Nucleotide Excision repair?
How is strand specificity solved in Base Excision Repair?
Why are the base removal enzymes called glycosylases?
The ung gene encodes the Uracil Glycosylase. What happens to E. coli DNA in an ung - mutant?
E. coli ung mutants grow poorly, and are abnormally sensitive to Nitrous Acid mutagenesis. What type of mutagenic action do you think Nitrous Acid causes?
The E. coli dut gene encodes a dUTPase, an enzyme that cleaves dUTP. The E. coli dut - mutant appears to have abnormally short Okazaki fragments. How can you account for this?
Synthesis of the short Okazaki fragments by the E. coli dut - mutant is suppressed by second mutations in the ung gene, ie Okazaki fragments are of normal length in the double mutant E. coli ung - dut - . How can you account for this?
The E. coli gene xth encodes EndoVI, the major AP nuclease activity of E. coli. E. coli dut - xth - double mutants grow very poorly. Why do think this is the case?
The TRIPLE mutant E. coli ung - dut - xth - grows fine, ie mutations in the ung gene suppresses the effects of mutations in the dut - xth - double mutant. Can you explain this?
How is E. coli EndoII (Goldthwait enzyme) different from most other AP nucleases?
What is an AP nuclease and what types of reactions do AP nucleases catalyze?
The above repair systems are nearly all "error-free". What is meant by this?
What type of repair does the E. coli MutHLS repair system repair?
What are the steps in MutHLS repair? How is the Strand Specificity problem solved? Is repair "short", "very short", or "long" patch repair? Why?
What are the basic steps in Post-replication Recombination-mediated repair?
Why do you think a gap is left opposite DNA damage when a replication fork moves by?
What is meant by Sister Chromatid Exchange?
What is the SOS response? Understand how activation of SOS occurs...and how SOS is turned off.
What is LexA protein? Why is it called a Repressor? What is a Repressor? What is another example of a Repressor?
Several genes are activated as result of SOS, including uvr, ruv, and umu genes. What are the ruv genes and what do they do? What are the umu genes and what do they do?
What is "error prone" repair? How is it part of the SOS response? What is its connection to UV mutagenesis?
Mutations in umu genes are mostly Anti-Mutator mutations. What is an Anti-Mutator mutation? What is the connection between these mutations and "error-prone" repair?
The uvr genes are involved in Nucleotide Excision. Why then are they expressed as part of the SOS response?
A gene expressed as part of the SOS response is the sulA gene; the SulA protein is an inhibitor of cell division. What advantage does sulA expression in SOS confer on the bacterial cell?
What are the roles of RecA and LexA proteins in the SOS response? What happens to their expression patterns?
What is homologous recombination?
What cytological evidence supports the notion of Breakage and Reunion in homologous recombination?
What is Breakage and Reunion?
What are the essential steps in a breakage-reunion model of recombination?
What E. coli enzymes can catalyze each of these steps?
What are the two major enzymatic properties of E. coli RecA protein?
What are the essential properties needed of two DNA molecules for Strand Assimilation by RecA to take place?
How does the E. coli RecBCD nuclease work? What is a Chi site?
What is Branch Migration? What is Strand Isomerization? What is a Holliday Junction?
What is a D-loop, and what role does it play in recombination?
It is sometimes said: given appropriate DNA polymerase, endonuclease, and exonuclease activity, any specific model of Breakage and Reunion can be rationalized. Is this reasonable? Why or why not?
What are Reciprocal Recombinants?
What is a heteroduplex molecule? Understand this at the level of DNA structure and at the level of genetic markers or alleles.
How can recombination events result in heteroduplex regions but no reciprocal recombinants?
Can Double Strand Breaks be repaired via a Breakage-Reunion Mechanism? If so, how?
How can DNA repair following recombination account for Gene Conversion events?
What is the difference between Gene Conversion and Post-Meiotic Segregation?
What is a bacterial Genetic Mobile Element? Why are they called "hopping genes"/
What are the two major types of transposable elements (another name for Genetic Mobile Element)?
Why do these elements often cause mutations?
What types of mutations do they cause?
What are the usual mechanisms for "genome evolution"?
What is polarity?
Why are polar mutants often produced by transposition events?
What is an Insertion Sequence (IS)?
What is the basic structure of an IS element?
What protein is encoded by an IS element and what is its function?
When an IS element hops, what happens to the host target DNA?
What is the host target DNA?
Upon hopping, the host DNA structure is said to be "diagnostic" for a transposable element. What does this mean?
What are ITRs? What is their role in transposition?
What is the typical transposition frequency? why is it a good idea to keep this frequency low?
What is "precise excision" of a transposable element? Why does it seldom occur?
What is a transposon? What is a composite transposon?
What is the general structure of a composite transposon?
How does the structure of a transposon differ from that of an IS element?
What is a drug resistance gene?
What is an "inside-out" transposon? How is it formed?
What happens when a reciprocal recombination event occurs between two direct repeats?
What happens when a reciprocal recombination event occurs between two inverted repeats?
What types of mutations can such events lead to?
What are the three general mechanisms for transposition?
What is phage Mu?
What happens to Mu DNA upon infection of an E. coli cell?
How is Mu DNA replicated in an infected cell?
What does "replicon fusion" mean?
How is the duplication of the host target DNA site brought about?
What is a Cointegrate? What is the Crossover structure?
What are the steps that lead to formation of Cointegrate during a transposition event?
In which transposition mechanisms is a Cointegrate NOT formed?
What does "Resolution of the Cointegrate" mean? What enzyme catalyzes this Resolution? Where is the gene encoding this enzyme?
What enzyme catalyzes the DNA synthesis events in transposition?
What enzyme catalyzes the DNA nicking events in transposition?
What enzyme catalyzes the DNA ligation events in transposition?
Name two members of the TnA family of transposons.
Why are these transposons NOT considered to be Composite transposons?
What 3 genes are encoded by a TnA transposon? What are the functions are each of the proteins encoded by these 3 genes?
What is the Res region? How does it function in Resolution? What is unusual about this resolution event?
What other function(s) are found in the Res region?
What is the nature of the interaction of Resolvase with the Res region?
What is Resolvase and what are its functions in the TnA transposon family?
How does Resolution of the TnA transposition Cointegrate resemble generalized recombination? how does it differ from generalized recombination?
Tn10 is an example of what type of transposon?
What is the structure of Tn10?
Why does Tn10 exhibit "hot spots" in terms of its hopping pattern?
What are the Pin and Pout promoters? What are their functions?
What three mechanisms does Tn10 use to limit the amount of its hopping?
What is "Multicopy inhibition"? What role does an Antisense RNA play in this inhibition? Which RNA species is the Antisense RNA?
What is an Antisense RNA? Provide an example of ANOTHER Antisense RNA seen in this course.
What does "cis-preference" mean? How does this concept apply to Tn10?
What role does the GATC site in Pin play in Tn10 transposition?
What role does the GATC site in the ITR play in Tn10 transposition?
What is a retrovirus?
What is a retroposon?
Characterize the differences in the "life cycle" of a retrovirus vs that of a retroposon.
What is the structure of a retrovirus? What is its genetic material?
How does a retrovirus infect its host? How are progeny virus released by the host?
What is the host of a retrovirus?
Lewin states "the retrovirus life cycle involves transposition-like events." What does this mean?
What is the overall replication process for a retrovirus?
Do human beings harbor any retroviral genomes? If yes, in what state? Is this a concern?
What is the "endogenous provirus"?
What are the typical "genes" of a retrovirus?
What other genetic elements are harbored on the retroviral genome?
What is meant be the statement "the genes of a retrovirus are expressed as polyproteins"?
What is a polyprotein?
Are retroviruses plus strand RNA viruses or minus strand RNA viruses? What do these terms mean?
How are progeny virus genomes synthesized?
What are the protein products of each of the retroviral "genes"? What are their functions?
What is reverse transcriptase?
How is reverse transcriptase useful in recombinant DNA technology?
What is RNaseH?
What are the steps in the conversion of the viral genome into the linear DNA form?
What happens to the linear DNA form?
How does the linear DNA form differ from the provirus form?
What genetic elements does the linear DNA form possess that are absent on the viral genome?
How do these arise during the replication process?
What is(are) the mechanism(s) whereby there are many more copies of the gag proteins than of the pol proteins?
What proteins are encoded by the gag "gene"? by the pol "gene"?
How is the env "gene" expressed? What are the functions of the env proteins?
What is the viral Integrase, and what is its function?
What are the viral U3 and U5 regions?
What is the R region? What is its function in the replication process?
What is the initial primer used in the replication process? What is the second primer?
How do positions of these two primers on the viral genome account for LTR duplication?
What is an LTR?
Why is RNaseH function critical during replication of the viral genome?
Why is reverse transcriptase available immediately upon infection of a host cell?
What is the "end replication" problem? How is it solved during retrovirus replication?
Where is the promoter for retroviral gene expression? What form of the retrovirus is transcribed?
How can transcription from the retrovirus lead to a "transformed", carcinogenic cell?
What is a mechanism for integration of the viral linear DNA into the chromosome? (See Alberts et al, Molecular Biology of the Cell, p. 273, Fig. 6-70)
What are some examples of retroposons?
What is cDNA cloning?
What is a cDNA?
Why is sequencing of cDNA molecules advocated in the human genome program?
What is an EST? Why are ESTs useful?
What is the process of Transcription?
What types of RNA molecules are made in a prokaryotic cell?
What is the cellular function of each of these RNA species? How stable are each of these species?
Understand what is meant by Upstream and Downstream from a Promoter.
What is a Promoter?
What are the 4 major elements of a Prokaryotic Promoter? How were these determined?
What is a promoter down mutant? What is a promoter up mutant?
What is the structure of E. coli CoreRNApolymerase? Where is it found in the E. coli cell?
What is the structure of E. coli HoloRNApol? Where is it found in the E. coli cell?
Is the E. coli RNA polymerase the simplest
type of RNA polymerase on earth? Why or why not?
The most complex type of RNA polymerase on earth? Why or why not?
What is a sigma factor?
What is the main function of a sigma factor?
Why is the main E. coli sigma factor called the s 70 sigma factor?
What other sigma factors are found in E. coli? What are their functions?
The statement is made: Temporal expression
of genes can be regulated via expression of new sigma factors.
Explain what is meant by this.
What are the events that occur during Initiation of a Transcription event?
What is a Loose Binding Complex, and what molecules are involved?
What is a Tight Binding Complex, and what molecules are involved?
What is the difference between the Tight Binary Complex and the Open Binary Complex, and what molecules are involved?
What is Abortive Initiation?
What is the Ternary Complex, and what molecules are involved?
What is meant by "Promoter Clearing Time"?
Understand how one does a DNA Footprinting experiment.
What similar and what different types of information are provided in the two following types of DNA footprinting experiments:
a. Protein is bound to DNA, then DNA is treated with base-modifying chemicals, and analyzed on a sequencing gel.
b. DNA is treated with base-modifying chemicals, then Protein is bound to treated DNA, and unbound DNA molecules are analyzed on a sequencing gel.
What results were obtained when footprinting expts were done with HoloRNApol and Promoter regions?
How do these results compare with promoter up and down mutation results?
What is the basic reaction for Elongation in Transcription?
What happens to sigma factor during elongation?
What happens to CoreRNApol during elongation?
How does the rate of transcription compare with the rate of DNA replication?
Unwinding and movement of RNA polymerase increases the number of DNA turns ahead of the transcription fork and decreases this number behind the fork. W-C DNA twists remain constant. What happens to the supercoil density ahead of, and behind, the fork?
What is a Rho-independent Termination site? What is its structure? How does it function to terminate transcription events?
What is a Rho-dependent Termination site? What is its structure? How does it function to terminate transcription events? How is Rho thought to function?
What is an operon?
What does the phrase "coordinately expressed" mean?
How is "coordinate expression" usually achieved? How might it be achieved for genes which are NOT adjacent to each other?
How would you define an operon for genes which are coordinately expressed but which are not adjacent to each other?
What is the main purpose of gene expression regulation via operons? Why is this particularly appropriate for prokaryotic organisms? Why is it NOT appropriate for regulation of genes involved in developmental processes, eg embryogenesis in higher organisms?
What are the "DNA control elements" found in operons?
What are structural genes? What are regulator genes? Why are the products of regulator genes in operons usually negatively-acting? What does "negatively-acting" mean?
What genetic mutations are the most convincing that the products of regulator genes are negatively-acting?
Could the product of the regulator gene by positively-acting?
What is the Repressor? What is the Operator? What is an Attenuator?
What is "constitutive expression"?
What is an Inducer? What is a Co-Repressor? What is Allosterism? How is allosterism important in operon theory?
What is a "trans-acting factor"? What is a "cis-acting element"?
What are the two general classes of Operons?
What types of metabolic processes are characterized by each of these two classes? Where would genes involved in intermediary metabolism, eg genes encoding the Embdon-Meyerhof proteins fit in this scheme? Where would the dna or pol genes fit in this scheme?
Which of these types of processes are characterized by Inducers of the operon? Co-Repressors of the operon?
In what ways are the two classes of operons similar to each other? in what ways are they different?
In the Lac operon, how many structural genes are there? what are the functions of the gene products of these genes? what is (are) the Inducer molecule(s)? what is the level of induction? why is it called "induction"? what happens to gene expression and the products of gene expression of the Lac operon when Inducer is removed from the growth medium? why is instability of the mRNA important here?
What is the product of the lacI gene? how is expression of this gene controlled? what is the function of the lacI gene product? how does it work?
What types of lacI mutants are there? where do these map in the lacI gene? what are the phenotypes of these mutants?
What are the dominance relationships of these mutant types to a lacI + gene? what are their dominance relationships TO EACH OTHER?
What does "dominance relationship" mean? How are "dominance relationships" measured? What is "complementation"?
Complementation is NOT related to Recombination or measurement of recombinants!! Why do students sometimes think they are related?
What types of lacO mutants are there? How are the positions of these mutations related to positions of protection of lac DNA by Repressor in DNA footprinting experiments?
What are lacO mutants called? what are their phenotypes?
What is the phenotype of a deletion of lacI? of a deletion of lacO? why are these the most convincing type of mutation regarding the question of postive vs negative control of the operon?
What is Cis-Dominance? What types of lac mutants exhibit Cis-Dominance? How is this experiment done?
Regarding phenotypes of these mutants, what does "constitutive" mean? what does "non-inducible" mean?
When Repressor is bound to Operator, what happens when Inducer is added to the growth medium?
What is the mechanism by which Repressor prevents transcription when bound to Operator?
What is "catabolite repression"? How is it related to the "glucose effect"? What is the "glucose effect"?
What is cAMP? what is its role in catabolite repression? how is it related to presence or absence of glucose in the growth medium?
What types of operons are subject to catabolite repression? What is the rationale for having this regulation system?
What is CAP protein? What does CAP mean? How does it function in catabolite repression?
The cAMP-CAP complex act as an ACTIVATOR of transcription. Why then is this called "catabolite repression"?
What is the "CAP binding site"? How is it positionally related to the Operator? to the Promoter? to the Regulator gene?
What are the effects of cAMP-CAP binding on RNA polymerase? on DNA at the CAP binding site?
How is catabolite repression a mechanism for environment adaptation?
In the Trp operon, how many structural genes are there? what are the functions of the gene products of these genes? what is (are) the Co-Repressor molecule(s)? what is the level of derepression? why is it called "derepression"? what happens to gene expression and the products of gene expression of the Trp operon when Co-Repressor is added to the growth medium? why is instability of the mRNA important here?
What is the product of the trpR gene? how is expression of this gene controlled? what is the function of the trpR gene product? how does it work?
What is "feedback inhibition"? why is the word "feedback" used here? what molecule is involved in the "feedback"? what does this molecule do in feedback inhibition?
How does feedback inhibition differ from the repressor control mechanism? why does it act more quickly? Why have a repressor control mechanism if feedback inhibition acts more quickly?
What class of operon is the Trp operon? how do the effects of the small molecule differ here from the effects of the small molecule in the other class of operon? what are examples of the small molecules used in control by these two classes of operons?
What is attenuation control? What is the role of the Attenuator in this control?
What is the Leader Peptide? What is the function of this peptide? What structural feature of the peptide permits it to function in this way?
How is coupled transcription:translation important to an understanding of attenuation?
What is the structure of the Attenuator? What alternative structural forms can the Attenuator have? How are these alternative structures important to attenuation control of transcription of the Trp genes?
What role does Tryptophane play in attenuation? How is this role consistent with the need to express the Trp operon when Tryptophane is absent? the need to repress expression of the Trp operon when Tryptophane is present?
What is bacteriophage lambda? What is a bacteriophage? How does it differ from a phage? How does it differe from a virus?
What is the structure of Lambda?
What is the genome of Lambda? what are important structural features of the genome? what are important genetic organization features of the genome?
How have conditional lethal mutants been useful in delineating lambda genes? What types of conditional lethal mutants have been mainly obtained? What is the experimental system for obtaining such mutants? What nomenclature was used in the naming of the genes so identified?
Given two such mutants, the cis-trans complementation test was used to determine if the two mutations were in the same gene. What is the cis-trans complementation test? How is the experiment done? How is this test relevant to the concept of the Cistron? What is a Cistron? a Muton? a Recon?
The cis-trans complementation test is NOT related to Recombination or measurement of recombinants!! Why do students sometimes think they are related?
Another major class of lambda mutants are those that show altered plaque morphology. What paper in this course used such mutants as a primary assay system? What phage was used? Could similar mutants be obtained for phage lambda? What would you imagine the phenotype of such mutants to be? How do you think this phenotype is related to the "C" in the names of the CI, CII, and CIII lambda genes?
What is the host for lambda? How does lambda infect its host? What two main possibilities are there for the phage life cycle?
What are the major events of the lytic cycle? What happens to the host? How many progeny phage are made? what is "lysis from within"?
What are the major events of the lysogenic response? What is lysogeny? What happens to the host? What happens to lambda?
A lysogenic bacterium is said to be "immune" to further lambda infection. What does this mean? What happens to the phage genome when a lambda phage infects a lysogenic coli cell?
Can lambda ever "come out of" a lysogenic cell? What is this process called? How can it occur? One way for this to occur is via induction of the SOS response. Why is this the case? A temperature-sensitive CI repressor called CI857 was used in the Gross et al HtpR paper. How is this mutant CI relevant here?
If a coli lysogenic Hfr cell is conjugated with a coli non-lysogenic F- recipient, and the lambda prophage is permitted to enter the recipient cell, the recipient cell ends up lysing and releasing progeny lambda phage. Explain how this might occur. [This is called "Zygotic Induction"]
What happens to phage lambda DNA when it is injected into a coli host cell? What are the "sticky ends" of Lambda DNA?
What are the first transcription events (Immediate Early or Early Early)in the lambda life cycle? What promoters are used? What lambda genes are expressed? Which of these genes are related mainly to the lytic response? which mainly to the lysogenic response?
What transcription termination events occur? How are these transcripts related to the discovery of Rho factor? What is Rho factor and what does it do?
What are the second set of transcription events (Delayed Early or Middle) in the lambda life cycle? What genes are expressed? Which of these genes are related mainly to the lytic response? which mainly to the lysogenic response?
What is the difference between promoters used in Immediate Early vs those used Delayed Early transcription? What is the difference in HoloRNApol structure?
What is the difference between Immediate Early and Delayed Early transcription? What lambda gene product is responsible? Why is this product then called an Anti-Terminator?
What are Nus proteins? What do each of the letters in "Nus" mean? What genome encodes the Nus proteins? How do each of the Nus proteins function in the difference between Immediate Early and Delayed Early transcription?
What are the Nut sites? How many are found on the lambda genome? Where are they located? How do they function in anti-termination? What are the BoxA and BoxB sites? What is their function? What is the relevance of RNA polymerase pausing to anti-termination? How is this consistent with the proposed mechanism of Rho function?
Understand different mechanisms for temporal control of gene expression: anti-termination, new sigma factors, RNA polymerase modifications, new RNA polymerases ... combinations of these.
What lambda gene product "turns on" Late lambda transcription? When is it synthesized? How is this timing related to the timing of Late transcription? How does this gene product work? Which lambda genes are expressed in this Late transcription event? Which are related to the lytic response? to the lysogenic response?
How does the temporal expression of the above genes lead to the statement: The lytic response begins immediately upon lambda infection and proceeds at an even, constant pace. ?
What two types of recombination events can be catalyzed by lambda gene products? Which lambda genes (or sets of genes) are involved in each recombination type? Which are related to the lytic response? to the lysogenic response?
What are the CII and CIII proteins? What is each of their functions? What is the role of cAMP and CAP protein in the function of the CII and CIII proteins? Are these functions related to the lytic or to the lysogenic response?
What is the PRE promoter? What is it used for? How does transcription from PRE lead to an "anti-sense" RNA? How does this antisense RNA function in the lysogeny-lytic response decision?
What is the PI promoter? What is it used for? How is this related to the lysogeny-lytic response decision?
What is the CI gene product? How does it function? Why is it said that CI and Cro products are "antagonistic repressors"? How does each function in the lysogeny-lytic response decision?
What are the structures of the OL and OR operators? Which proteins bind to these operators? How do they bind as a function of the structure of these operators? How are these binding properties related to the antagonistic properties of CI and Cro repressors?
What is the PRM promoter? What is it used for? How is this related to the lysogeny-lytic response decision?
What gene(s) are expressed from the lambda genome in a lysogenic cell? Why are no other lambda genes expressed? What is the name of the lambda genome in a lysogenic cell? How does the structure of the lambda genome in a lysogenic cell differ from the structure of the lambda genome in a lambda phage particle?
The lambda genome in a lysogenic cell can be considered to be an Operon in the E. coli chromosome. Why is this?
It is said that the key to establishing the lysogenic response is concentration of cAMP in the E. coli cell. Why is this? Why does this mechanism make sense in terms of a lambda "decision" to enter the lysogenic response vs the lytic response as a function of the growth environment of the E. coli host cell?
The temporal expression of lambda genes leading to the lysogenic response does NOT begin immediately upon lambda infection and proceed at an even, constant pace. Explain how this statement is true. What are the key events for the lysogenic response to "subvert and replace" the lytic response?
Viral "host range" mutants extend (or decrease) the range of hosts that can be used by the virus. In what class of lambda genes would you expect to find mutations that extend the lambda host range?
In what lambda genes would you expect to find lysis mutants? What would be the phenotype of these mutants? How might such mutants be valuable in working with phage lambda?
Lambda "immunity" mutants ( limm) can bypass immunity, ie can infect lysogenic cells. The only known limm mutant containing point mutations is one which has base substitutions in BOTH OR and OL. How would mutations in OR and OL confer such immunity? Why are mutations in BOTH OR and OL necessary to generate an immunity mutant? What would the plaque morphology of such a mutant be?
Lambda is one of several known "lambdoid" bacteriophage, all of which show similar "life styles" to lambda. One such lambdoid phage is phage 434. A chimeric phage called limm434 has been constructed (by general recombination, prior to recombinant DNA methodology ... very hard to do) in which the N-PL-OL-CI-OR-PR-Cro region of lambda is replaced by that of phage 434. The 434 operators are only recognized by the 434 CI and Cro proteins, and the same for lambda. Would a cell lysogenic for limm434 be immune to lambda? to 434? to l imm434? to all three? Would a cell lysogenic for lambda be immune to lambda? to 434? to l imm434? to all three?
Lambda(imm434) is another example of a lambda(imm) mutant? Why could one not simply generated a lambda(imm) mutant by deleting the OL and OR regions?
| BIMM100 | Syllabus
| Sections / Off Hrs | Grading
Policy | DNASYSTEM
|
| Lectures | Journal
Articles | Study Qs | Lab
Techniques | Exams |
If you have problems or comments, send email to Doug Smith