BILD 1							Dr. Nigel Crawford
Winter 1997						Due: Th, March 13, 1997
PROBLEM SET # 6

1.  How do silent, missense, nonsense and frameshift mutations differ and 
how are they the same?

2.  Give the mRNA sequences produced by transcribing the following DNA 
given that the bottom strand is the anti-sense or template strand:

	5'GGTATGGCAGAGACGTTGGAGTTACTGGGTGGGATTTGA 3'
	3'CCATACCGTCTCTGCAACCTCAATGACCCACCCTAAACT 5'

Using a codon table (pg. 303 in 4th ed of text), give the amino acid 
sequence of the protein produced by translating this mRNA.

3.	What is an operator and what is its function?  How does it differ 
from a promoter?

4.	Describe how an activator protein works on an inducible system or 
operon.  Describe how an activator protein would work in a repressible 
system.

5.	Besides controlling the transcription of a gene, how can a cell 
regulate expression of a given gene (where expression is defined as the 
production of active enzyme)? 

6.	Describe the genome of a virus (ie. what is its genetic material and 
what are its general features).  How is this genome protected from the 
environment when it is released from the host?

7.	What distinguishes a retrovirus from other viruses?  How does a 
retrovirus genome replicate and what unique enzyme is needed for this 
replication?  How is this unique enzyme useful for DNA cloning.

8.	What are plasmids?  What are restriction enzymes?  How were 
restriction enzymes discovered?

9.	If you digest a circular plasmid (4kb in length with a single Eco RI 
site 1.5 kb from the origin of replication) with Eco RI, how many fragments 
would you get and how big would they be?